Review



adeno associated virus backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc adeno associated virus backbone
    Adeno Associated Virus Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-EF1a-Cre+(Plasmid+%2355636)/pmc12993198-219-14-23
    Average 94 stars, based on 69 article reviews
    adeno associated virus backbone - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Generated:

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: .. pAAV/L7-6-EGFP-WPRE was generated from pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462; http:// n2t.net/addgene:126462; RRID:Addgene_126462) and the pAAV backbone from pAAV-hSyn-mScarlet (a gift from Karl Deisseroth, Addgene plasmid #131001; http://n2t.net/addgene:131001; RRID:Addgene_131001) using NEBuilder HiFi DNA Assembly (NEB). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers.

    Article Title: Autophagy regulator ATG5 preserves cerebellar function by safeguarding its glycolytic activity
    Article Snippet: EGFP-hATG5 was amplified (see primer sequence in Supplementary Table ), PCR product and pAAV-mDlx-GFP-Fishell-1 were digested, using SgsI-FD and NcoI-FD (both ThermoFisher Scientific), and ligated with T4 DNA Ligase (NEB). .. A pAAV/L7-6-EGFP-WPRE construct was generated from pAAV/L7-6-GFP-WPRE (Addgene, 126462) and the pAAV backbone from pAAV-hSyn-mScarlet (Addgene, 131001) using NEBuilder HiFi DNA Assembly (NEB). .. Subsequently, pAAV/L7-6-mKeima-Red-WPRE was generated from pAAV/L7-6-EGFP-WPRE and mKeima-Red-N1 (Addgene, 54597) using NcoI and HindIII restriction sites.

    Article Title: Excitation creates a distributed pattern of cortical suppression due to varied recurrent input.
    Article Snippet: For Emx1-Cre animals, 300 nL of AAV9-syn-jGCaMP7s-WPRE (RRID:Addgene_10448747) and/or AAV9-Syn-DIO-stChrimsonRmRuby (RRID:Addgene_10544848) were injected 250 mm below the dura (200 nL/min) prior to cementing the cranial window. .. For Ai148 and 162 animals, AAV9-CamKIIa-stChrimsonR-mRuby2 was generated by cloning the CaMKIIa promoter (RRID: Addgene_12021949) into a pAAV backbone containing stChrimsonR-mRuby2 (RRID:Addgene_10544748) and packaged into an AAV (Vigene, Inc.). ..

    Article Title: Autophagy regulator ATG5 preserves cerebellar function by safeguarding its glycolytic activity.
    Article Snippet: EGFP-hATG5 was amplified (see primer sequence in Supplementary Table 1), PCR product and pAAV-mDlx-GFP-Fishell-1 were digested, using SgsI-FD and NcoI-FD (both ThermoFisher Scientific), and ligated with T4 DNA Ligase (NEB). .. A pAAV/L7-6-EGFP-WPRE construct was generated from pAAV/L7-6-GFP-WPRE (Addgene, 126462) and the pAAV backbone from pAAV-hSyn-mScarlet (Addgene, 131001) using NEBuilder HiFi DNA Assembly (NEB). .. Subsequently, pAAV/L7-6-mKeima-Red-WPRE was generated from pAAV/ L7-6-EGFP-WPRE and mKeima-Red-N1 (Addgene, 54597) using NcoI and HindIII restriction sites.

    Plasmid Preparation:

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: .. pAAV/L7-6-EGFP-WPRE was generated from pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462; http:// n2t.net/addgene:126462; RRID:Addgene_126462) and the pAAV backbone from pAAV-hSyn-mScarlet (a gift from Karl Deisseroth, Addgene plasmid #131001; http://n2t.net/addgene:131001; RRID:Addgene_131001) using NEBuilder HiFi DNA Assembly (NEB). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers.

    Article Title: Development and testing of a versatile genome editing application reporter (V-GEAR) system
    Article Snippet: .. V-GEAR plasmid construct was synthesized into pAAV backbone (Addgene, plasmid #32395). .. Custom MND, RQR8, eGFP, Red Luciferase, and NIS were synthesized (Genscript) and cloned into the backbone replacing the CMV promoter sequence.

    Article Title: An antisense oligonucleotide efficiently suppresses splicing of an alternative exon in vascular smooth muscle in vivo.
    Article Snippet: Targeting alternative exons for therapeutic gain has been achieved in a few instances and potentially could be applied more broadly.. The myosin phosphatase (MP) enzyme is a critical hub upon which signals converge to regulate vessel tone.. Alternative exon 24 of myosin phosphatase regulatory subunit (Mypt1 E24) is an ideal target as toggling between the two isoforms sets smooth muscle sensitivity to vasodilators such as nitric oxide (NO).

    Article Title: A Critical Role for γCaMKII in Decoding NMDA Signaling to Regulate AMPA Receptors in Putative Inhibitory Interneurons.
    Article Snippet: CaMKII is essential for long-term potentiation (LTP), a process in which synaptic strength is increased following the acquisition of information.. Among the four CaMKII isoforms, cCaMKII is the one that mediates the LTP of excitatory synapses onto inhibitory interneurons (LTPE?I).. However, the molecular mechanism underlying how cCaMKII mediates LTPE?I remains unclear.

    Construct:

    Article Title: Development and testing of a versatile genome editing application reporter (V-GEAR) system
    Article Snippet: .. V-GEAR plasmid construct was synthesized into pAAV backbone (Addgene, plasmid #32395). .. Custom MND, RQR8, eGFP, Red Luciferase, and NIS were synthesized (Genscript) and cloned into the backbone replacing the CMV promoter sequence.

    Article Title: An antisense oligonucleotide efficiently suppresses splicing of an alternative exon in vascular smooth muscle in vivo.
    Article Snippet: Targeting alternative exons for therapeutic gain has been achieved in a few instances and potentially could be applied more broadly.. The myosin phosphatase (MP) enzyme is a critical hub upon which signals converge to regulate vessel tone.. Alternative exon 24 of myosin phosphatase regulatory subunit (Mypt1 E24) is an ideal target as toggling between the two isoforms sets smooth muscle sensitivity to vasodilators such as nitric oxide (NO).

    Article Title: Autophagy regulator ATG5 preserves cerebellar function by safeguarding its glycolytic activity
    Article Snippet: EGFP-hATG5 was amplified (see primer sequence in Supplementary Table ), PCR product and pAAV-mDlx-GFP-Fishell-1 were digested, using SgsI-FD and NcoI-FD (both ThermoFisher Scientific), and ligated with T4 DNA Ligase (NEB). .. A pAAV/L7-6-EGFP-WPRE construct was generated from pAAV/L7-6-GFP-WPRE (Addgene, 126462) and the pAAV backbone from pAAV-hSyn-mScarlet (Addgene, 131001) using NEBuilder HiFi DNA Assembly (NEB). .. Subsequently, pAAV/L7-6-mKeima-Red-WPRE was generated from pAAV/L7-6-EGFP-WPRE and mKeima-Red-N1 (Addgene, 54597) using NcoI and HindIII restriction sites.

    Article Title: Autophagy regulator ATG5 preserves cerebellar function by safeguarding its glycolytic activity.
    Article Snippet: EGFP-hATG5 was amplified (see primer sequence in Supplementary Table 1), PCR product and pAAV-mDlx-GFP-Fishell-1 were digested, using SgsI-FD and NcoI-FD (both ThermoFisher Scientific), and ligated with T4 DNA Ligase (NEB). .. A pAAV/L7-6-EGFP-WPRE construct was generated from pAAV/L7-6-GFP-WPRE (Addgene, 126462) and the pAAV backbone from pAAV-hSyn-mScarlet (Addgene, 131001) using NEBuilder HiFi DNA Assembly (NEB). .. Subsequently, pAAV/L7-6-mKeima-Red-WPRE was generated from pAAV/ L7-6-EGFP-WPRE and mKeima-Red-N1 (Addgene, 54597) using NcoI and HindIII restriction sites.

    Synthesized:

    Article Title: Development and testing of a versatile genome editing application reporter (V-GEAR) system
    Article Snippet: .. V-GEAR plasmid construct was synthesized into pAAV backbone (Addgene, plasmid #32395). .. Custom MND, RQR8, eGFP, Red Luciferase, and NIS were synthesized (Genscript) and cloned into the backbone replacing the CMV promoter sequence.

    Article Title: Cell type-specific gene therapy confers protection against motor neuron disease caused by a TFG variant.
    Article Snippet: Hereditary spastic paraplegias (HSPs) are a diverse group of inherited disorders that result in lower limb weakness and spasticity, generally thought to be caused by upper motor neuron degeneration.. However, it remains unclear whether axonopathy in HSP arises directly from impaired neuron function or the loss of supporting neuroglia.. In this work, we establish a rapid-onset animal model of HSP that recapitulates disease phenotypes exhibited by patients, providing a unique opportunity to test therapeutic interventions.

    Homologous Recombination:

    Article Title: A Critical Role for γCaMKII in Decoding NMDA Signaling to Regulate AMPA Receptors in Putative Inhibitory Interneurons.
    Article Snippet: CaMKII is essential for long-term potentiation (LTP), a process in which synaptic strength is increased following the acquisition of information.. Among the four CaMKII isoforms, cCaMKII is the one that mediates the LTP of excitatory synapses onto inhibitory interneurons (LTPE?I).. However, the molecular mechanism underlying how cCaMKII mediates LTPE?I remains unclear.

    Amplification:

    Article Title: A Critical Role for γCaMKII in Decoding NMDA Signaling to Regulate AMPA Receptors in Putative Inhibitory Interneurons.
    Article Snippet: CaMKII is essential for long-term potentiation (LTP), a process in which synaptic strength is increased following the acquisition of information.. Among the four CaMKII isoforms, cCaMKII is the one that mediates the LTP of excitatory synapses onto inhibitory interneurons (LTPE?I).. However, the molecular mechanism underlying how cCaMKII mediates LTPE?I remains unclear.

    Cloning:

    Article Title: Excitation creates a distributed pattern of cortical suppression due to varied recurrent input.
    Article Snippet: For Emx1-Cre animals, 300 nL of AAV9-syn-jGCaMP7s-WPRE (RRID:Addgene_10448747) and/or AAV9-Syn-DIO-stChrimsonRmRuby (RRID:Addgene_10544848) were injected 250 mm below the dura (200 nL/min) prior to cementing the cranial window. .. For Ai148 and 162 animals, AAV9-CamKIIa-stChrimsonR-mRuby2 was generated by cloning the CaMKIIa promoter (RRID: Addgene_12021949) into a pAAV backbone containing stChrimsonR-mRuby2 (RRID:Addgene_10544748) and packaged into an AAV (Vigene, Inc.). ..

    Bioprocessing:

    Article Title: Excitation creates a distributed pattern of cortical suppression due to varied recurrent input.
    Article Snippet: For Emx1-Cre animals, 300 nL of AAV9-syn-jGCaMP7s-WPRE (RRID:Addgene_10448747) and/or AAV9-Syn-DIO-stChrimsonRmRuby (RRID:Addgene_10544848) were injected 250 mm below the dura (200 nL/min) prior to cementing the cranial window. .. For Ai148 and 162 animals, AAV9-CamKIIa-stChrimsonR-mRuby2 was generated by cloning the CaMKIIa promoter (RRID: Addgene_12021949) into a pAAV backbone containing stChrimsonR-mRuby2 (RRID:Addgene_10544748) and packaged into an AAV (Vigene, Inc.). ..

    Clone Assay:

    Article Title: Cell type-specific gene therapy confers protection against motor neuron disease caused by a TFG variant.
    Article Snippet: Hereditary spastic paraplegias (HSPs) are a diverse group of inherited disorders that result in lower limb weakness and spasticity, generally thought to be caused by upper motor neuron degeneration.. However, it remains unclear whether axonopathy in HSP arises directly from impaired neuron function or the loss of supporting neuroglia.. In this work, we establish a rapid-onset animal model of HSP that recapitulates disease phenotypes exhibited by patients, providing a unique opportunity to test therapeutic interventions.



    Similar Products

    94
    Addgene inc adeno associated virus backbone
    Adeno Associated Virus Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-EF1a-Cre+(Plasmid+%2355636)/pmc12993198-219-14-23
    Average 94 stars, based on 1 article reviews
    adeno associated virus backbone - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Addgene inc paav cag flex backbone
    Paav Cag Flex Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-hSyn-DIO-hM3D(Gq)-mCherry+(Plasmid+%2344361)/pmc13043784-245-8-12
    Average 96 stars, based on 1 article reviews
    paav cag flex backbone - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc cre dependent aav backbone
    Cre Dependent Aav Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-hSyn-DIO-hM3D(Gq)-mCherry+(Plasmid+%2344361)/bio_rxiv__64898__2026__03__26__714551-145-22-26
    Average 96 stars, based on 1 article reviews
    cre dependent aav backbone - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    OriGene paav hadiponectin w backbone
    Paav Hadiponectin W Backbone, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/Slit3+(NM_011412)+Mouse+Tagged+ORF+Clone/pmc13018599-295-18-12
    Average 94 stars, based on 1 article reviews
    paav hadiponectin w backbone - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Addgene inc aav2 vector backbone
    Aav2 Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-CAG-tdTomato+(codon+diversified)+(Plasmid+%2359462)/pm41856998-209-6-10
    Average 96 stars, based on 1 article reviews
    aav2 vector backbone - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Addgene inc paav gfp mcs 3flag wpre pa expression backbone
    Paav Gfp Mcs 3flag Wpre Pa Expression Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV%2ETBG%2EPI%2EeGFP%2EWPRE%2EbGH+(Plasmid+%23105535)/pmc12974833-110-24-27
    Average 94 stars, based on 1 article reviews
    paav gfp mcs 3flag wpre pa expression backbone - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    Addgene inc aav plasmid backbone
    Aav Plasmid Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV%2ESyn%2ENES-jRGECO1a%2EWPRE%2ESV40+(Plasmid+%23100854)/pm41775935-481-30-33
    Average 95 stars, based on 1 article reviews
    aav plasmid backbone - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    97
    Addgene inc paav cag gfp backbone
    Paav Cag Gfp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-CAG-GFP+(Plasmid+%2337825)/bio_rxiv__64898__2026__02__24__707802-186-15-17
    Average 97 stars, based on 1 article reviews
    paav cag gfp backbone - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    93
    Addgene inc paav hsyn 3xflag backbone
    Paav Hsyn 3xflag Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+backbone/pAAV-hSyn-3xFLAG-WPRE+(Plasmid+%23127862)/pmc12937594-41-26-28
    Average 93 stars, based on 1 article reviews
    paav hsyn 3xflag backbone - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results